| Basic information from miRBase |
| hairpin accession number: MI0001878 |
| Located between position 7137155 and 7137260 on chromosome 23 strand + |
| mature miRNAs for MI0001878: |
| dre-miR-1 (MIMAT0001768): TGGAATGTAAAGAAGTATGTAT |
| You can find this miRNA in ENTREZGENE: mirn1-1 (accession: 100033551) |
| References |
| [1]Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T, Genes Dev. 19:1288-1293(2005)., "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" |