| Basic information from miRBase |
| hairpin accession number: MI0001877 |
| Located between position 266415 and 266501 on chromosome Zv9_scaffold3540 strand + |
| Overlapping with antisense strand of BX842700.1-201 (intron 1). |
| (Ensemble: ENSDART00000077966) |
| mature miRNAs for MI0001877: |
| dre-miR-1 (MIMAT0001768): TGGAATGTAAAGAAGTATGTAT |
| You can find this miRNA in ENTREZGENE: mir1-2 (accession: 100033550) |
| References |
| [1]Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T, Genes Dev. 19:1288-1293(2005)., "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" |