| Basic information from miRBase |
| hairpin accession number: MI0001962 |
| Located between position 15177271 and 15177358 on chromosome 13 strand + |
| Overlapping with sense strand of zgc:158667-001 (intron 5). |
| (Ensemble: OTTDART00000037613) |
| mature miRNAs for MI0001962: |
| dre-miR-103 (MIMAT0001816): AGCAGCATTGTACAGGGCTATGA |
| You can find this miRNA in ENTREZGENE: mir103 (accession: 100033625) |
| References |
| [1]Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T, Genes Dev. 19:1288-1293(2005)., "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" |