| Basic information from miRBase |
| hairpin accession number: MI0001363 |
| Located between position 28705900 and 28705998 on chromosome 12 strand + |
| mature miRNAs for MI0001363: |
| dre-miR-10a (MIMAT0001267): TACCCTGTAGATCCGAATTTGT |
| dre-miR-10a* (MIMAT0003391): CAAATTCGTGTCTTGGGGAATA |
| You can find this miRNA in ENTREZGENE: mir10a (accession: 100033757) |
| References |
| [1]Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP, Science. 299:1540(2003)., "Vertebrate microRNA genes" |
| [2]Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T, Genes Dev. 19:1288-1293(2005)., "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" |