| Basic information from miRBase |
| hairpin accession number: MI0001364 |
| Located between position 1943755 and 1943832 on chromosome 9 strand - |
| Overlapping with sense strand of si:rp71-78h1.11-001 (exon 2). |
| (Ensemble: OTTDART00000047317) |
| mature miRNAs for MI0001364: |
| dre-miR-10b (MIMAT0001268): TACCCTGTAGAACCGAATTTGTG |
| You can find this miRNA in ENTREZGENE: mir10b-1 (accession: 100033758) |
| References |
| [1]Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP, Science. 299:1540(2003)., "Vertebrate microRNA genes" |
| [2]Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T, Genes Dev. 19:1288-1293(2005)., "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" |
| [3]Woltering JM, Durston AJ, Nat Genet. 38:601-602(2006)., "The zebrafish hoxDb cluster has been reduced to a single microRNA" |