miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0001887
Located between position 36181545 and 36181636 on chromosome 23 strand +
Overlapping with antisense strand of si:dkey-81p22.11-001 (intron 5).
(Ensemble: OTTDART00000019699)
mature miRNAs for MI0001887:
         dre-miR-10b (MIMAT0001268): TACCCTGTAGAACCGAATTTGTG
You can find this miRNA in ENTREZGENE: mir10b-2 (accession: 100033560)

References
[1]Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T, Genes Dev. 19:1288-1293(2005)., "The developmental miRNA profiles of zebrafish as determined by small RNA cloning"