miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0001966
Located between position 26793487 and 26793568 on chromosome 2 strand -
mature miRNAs for MI0001966:
         dre-miR-124 (MIMAT0001819): TAAGGCACGCGGTGAATGCCAA
You can find this miRNA in ENTREZGENE: mir124-1 (accession: 100033628)

References
[1]Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T, Genes Dev. 19:1288-1293(2005)., "The developmental miRNA profiles of zebrafish as determined by small RNA cloning"