miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0001979
Located between position 12065951 and 12066051 on chromosome 8 strand -
Overlapping with sense strand of si:ch211-248e11.2-003 (exon 2).
(Ensemble: OTTDART00000034876)
mature miRNAs for MI0001979:
         dre-miR-126a* (MIMAT0003157): CATTATTACTTTTGGTACGCG
         dre-miR-126a (MIMAT0001823): TCGTACCGTGAGTAATAATGC
You can find this miRNA in ENTREZGENE: mir126 (accession: 100033640)

References
[1]Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T, Genes Dev. 19:1288-1293(2005)., "The developmental miRNA profiles of zebrafish as determined by small RNA cloning"
[2]Wienholds E, Kloosterman WP, Miska E, Alvarez-Saavedra E, Berezikov E, de Bruijn E, Horvitz HR, Kauppinen S, Plasterk RH, Science. 309:310-311(2005)., "MicroRNA expression in zebrafish embryonic development"