| Basic information from miRBase |
| hairpin accession number: MI0001980 |
| Located between position 12504146 and 12504243 on chromosome 22 strand + |
| Overlapping with sense strand of si:ch73-60i13.2-001 (intron 5). |
| (Ensemble: OTTDART00000035435) |
| mature miRNAs for MI0001980: |
| dre-miR-128 (MIMAT0001824): TCACAGTGAACCGGTCTCTTTT |
| You can find this miRNA in ENTREZGENE: mirn128-1 (accession: 100033641) |
| References |
| [1]Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T, Genes Dev. 19:1288-1293(2005)., "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" |