| Basic information from miRBase |
| hairpin accession number: MI0001981 |
| Located between position 44518214 and 44518336 on chromosome 19 strand + |
| Overlapping with sense strand of si:ch73-92o9.2-201 (intron 17). |
| (Ensemble: ENSDART00000051724) |
| mature miRNAs for MI0001981: |
| dre-miR-128 (MIMAT0001824): TCACAGTGAACCGGTCTCTTTT |
| You can find this miRNA in ENTREZGENE: mir128-2 (accession: 100033642) |
| References |
| [1]Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T, Genes Dev. 19:1288-1293(2005)., "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" |