miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0001984
Located between position 34405305 and 34405389 on chromosome 10 strand -
Overlapping with sense strand of im:7140390-201 (intron 1).
(Ensemble: ENSDART00000023509)
mature miRNAs for MI0001984:
         dre-miR-130a (MIMAT0001826): CAGTGCAATGTTAAAAGGGCAT
You can find this miRNA in ENTREZGENE: mirn130a-1 (accession: 100033645)

References
[1]Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T, Genes Dev. 19:1288-1293(2005)., "The developmental miRNA profiles of zebrafish as determined by small RNA cloning"