| Basic information from miRBase |
| hairpin accession number: MI0001988 |
| Located between position 14491174 and 14491254 on chromosome 5 strand + |
| mature miRNAs for MI0001988: |
| dre-miR-130c (MIMAT0001828): CAGTGCAATATTAAAAGGGCAT |
| You can find this miRNA in ENTREZGENE: mir130c-2 (accession: 100033649) |
| References |
| [1]Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T, Genes Dev. 19:1288-1293(2005)., "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" |