| Basic information from miRBase |
| hairpin accession number: MI0002005 |
| Located between position 3156809 and 3156899 on chromosome 5 strand + |
| mature miRNAs for MI0002005: |
| dre-miR-142a-5p (MIMAT0001838): CATAAAGTAGAAAGCACTACT |
| dre-miR-142a-3p (MIMAT0003160): TGTAGTGTTTCCTACTTTATGGA |
| You can find this miRNA in ENTREZGENE: mir142a (accession: 100033664) |
| References |
| [1]Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T, Genes Dev. 19:1288-1293(2005)., "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" |
| [2]Wienholds E, Kloosterman WP, Miska E, Alvarez-Saavedra E, Berezikov E, de Bruijn E, Horvitz HR, Kauppinen S, Plasterk RH, Science. 309:310-311(2005)., "MicroRNA expression in zebrafish embryonic development" |