| Basic information from miRBase |
| hairpin accession number: MI0002006 |
| Located between position 14402913 and 14402998 on chromosome 15 strand - |
| mature miRNAs for MI0002006: |
| dre-miR-142b-5p (MIMAT0001839): CATAAAGTAGACAGCACTACTA |
| You can find this miRNA in ENTREZGENE: mir142b (accession: 100033665) |
| References |
| [1]Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T, Genes Dev. 19:1288-1293(2005)., "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" |