| Basic information from miRBase |
| hairpin accession number: MI0002009 |
| Located between position 43890656 and 43890744 on chromosome 5 strand - |
| Overlapping with sense strand of si:ch211-207c6.2-001 (exon 2). |
| (Ensemble: OTTDART00000022480) |
| mature miRNAs for MI0002009: |
| dre-miR-144 (MIMAT0001841): TACAGTATAGATGATGTACT |
| You can find this miRNA in ENTREZGENE: mir144 (accession: 100033668) |
| References |
| [1]Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T, Genes Dev. 19:1288-1293(2005)., "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" |