miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0002010
Located between position 40133370 and 40133482 on chromosome 14 strand +
mature miRNAs for MI0002010:
         dre-miR-145 (MIMAT0001842): GTCCAGTTTTCCCAGGAATCCC
You can find this miRNA in ENTREZGENE: mir145 (accession: 100033669)

References
[1]Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T, Genes Dev. 19:1288-1293(2005)., "The developmental miRNA profiles of zebrafish as determined by small RNA cloning"