| Basic information from miRBase |
| hairpin accession number: MI0002017 |
| Located between position 24387198 and 24387277 on chromosome 3 strand + |
| Overlapping with sense strand of copz2-003 (intron 1). |
| (Ensemble: OTTDART00000024536) |
| mature miRNAs for MI0002017: |
| dre-miR-152 (MIMAT0001847): TCAGTGCATGACAGAACTTTGG |
| You can find this miRNA in ENTREZGENE: mir152 (accession: 100033675) |
| References |
| [1]Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T, Genes Dev. 19:1288-1293(2005)., "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" |