| Basic information from miRBase |
| hairpin accession number: MI0002021 |
| Located between position 41878183 and 41878263 on chromosome 7 strand + |
| Overlapping with sense strand of ptprn2-001 (intron 12). |
| (Ensemble: OTTDART00000025249) |
| mature miRNAs for MI0002021: |
| dre-miR-153a (MIMAT0001849): TTGCATAGTCACAAAAGTGATC |
| You can find this miRNA in ENTREZGENE: mir153a (accession: 100033677) |
| References |
| [1]Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T, Genes Dev. 19:1288-1293(2005)., "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" |