| Basic information from miRBase |
| hairpin accession number: MI0002019 |
| Located between position 13891546 and 13891693 on chromosome 6 strand + |
| Overlapping with sense strand of BX323042.1-201 (intron 7). |
| (Ensemble: ENSDART00000109144) |
| mature miRNAs for MI0002019: |
| dre-miR-153b (MIMAT0001848): TTGCATAGTCACAAAAATGAGC |
| You can find this miRNA in ENTREZGENE: mir153b (accession: 100033676) |
| References |
| [1]Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T, Genes Dev. 19:1288-1293(2005)., "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" |