| Basic information from miRBase |
| hairpin accession number: MI0001893 |
| Located between position 27196742 and 27196875 on chromosome 7 strand + |
| mature miRNAs for MI0001893: |
| dre-miR-15b (MIMAT0001773): TAGCAGCACATCATGGTTTGTA |
| You can find this miRNA in ENTREZGENE: mir15b (accession: 100033566) |
| References |
| [1]Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T, Genes Dev. 19:1288-1293(2005)., "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" |