| Basic information from miRBase |
| hairpin accession number: MI0004779 |
| Located between position 1538892 and 1538974 on chromosome 15 strand + |
| Overlapping with sense strand of smc4-001 (intron 5). |
| (Ensemble: OTTDART00000025942) |
| mature miRNAs for MI0004779: |
| dre-miR-15c (MIMAT0003764): AAGCAGCGCGTCATGGTTTTC |
| You can find this miRNA in ENTREZGENE: mir15c (accession: 100033746) |
| References |
| [1]Kloosterman WP, Steiner FA, Berezikov E, de Bruijn E, van de Belt J, Verheul M, Cuppen E, Plasterk RH, Nucleic Acids Res. 34:2558-2569(2006)., "Cloning and expression of new microRNAs from zebrafish" |