| Basic information from miRBase |
| hairpin accession number: MI0001894 |
| Located between position 1539063 and 1539149 on chromosome 15 strand + |
| Overlapping with sense strand of smc4-001 (intron 5). |
| (Ensemble: OTTDART00000025942) |
| mature miRNAs for MI0001894: |
| dre-miR-16a (MIMAT0001774): TAGCAGCACGTAAATATTGGTG |
| You can find this miRNA in ENTREZGENE: mir16a (accession: 100033567) |
| References |
| [1]Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T, Genes Dev. 19:1288-1293(2005)., "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" |