| Basic information from miRBase |
| hairpin accession number: MI0001895 |
| Located between position 47219486 and 47219625 on chromosome 1 strand - |
| mature miRNAs for MI0001895: |
| dre-miR-16b (MIMAT0001775): TAGCAGCACGTAAATATTGGAG |
| You can find this miRNA in ENTREZGENE: mir16b (accession: 100033568) |
| References |
| [1]Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T, Genes Dev. 19:1288-1293(2005)., "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" |