| Basic information from miRBase |
| hairpin accession number: MI0001898 |
| Located between position 55420876 and 55420958 on chromosome 9 strand - |
| mature miRNAs for MI0001898: |
| dre-miR-17a (MIMAT0001777): CAAAGTGCTTACAGTGCAGGTA |
| You can find this miRNA in ENTREZGENE: mir17a-2 (accession: 100033571) |
| References |
| [1]Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T, Genes Dev. 19:1288-1293(2005)., "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" |