| Basic information from miRBase |
| hairpin accession number: MI0001906 |
| Located between position 205464 and 205550 on chromosome 14 strand - |
| Overlapping with sense strand of mcm7-201 (intron 13). |
| (Ensemble: ENSDART00000051890) |
| mature miRNAs for MI0001906: |
| dre-miR-19d (MIMAT0001785): TGTGCAAACCCATGCAAAACTGA |
| You can find this miRNA in ENTREZGENE: mir19d (accession: 100033579) |
| References |
| [1]Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T, Genes Dev. 19:1288-1293(2005)., "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" |