miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0001908
Located between position 28880675 and 28880822 on chromosome 10 strand -
mature miRNAs for MI0001908:
         dre-miR-21 (MIMAT0001787): TAGCTTATCAGACTGGTGTTGGC
You can find this miRNA in ENTREZGENE: mir21-1 (accession: 100033581)

References
[1]Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T, Genes Dev. 19:1288-1293(2005)., "The developmental miRNA profiles of zebrafish as determined by small RNA cloning"