| Basic information from miRBase |
| hairpin accession number: MI0010834 |
| Located between position 36859430 and 36859539 on chromosome 10 strand - |
| Overlapping with sense strand of zgc:110011-201 (intron 1). |
| (Ensemble: ENSDART00000109345) |
| mature miRNAs for MI0010834: |
| dre-miR-2184 (MIMAT0011288): AACAGTAAGAGTTTATGTGCT |
| You can find this miRNA in ENTREZGENE: mir2184 (accession: 100310763) |
| References |
| [1]Soares AR, Pereira PM, Santos B, Egas C, Gomes AC, Arrais J, Oliveira JL, Moura GR, Santos MA, BMC Genomics. 10:195(2009)., "Parallel DNA pyrosequencing unveils new zebrafish microRNAs" |