Basic information from miRBase |
hairpin accession number: MI0010842 |
Located between position 36885952 and 36886061 on chromosome 23 strand + |
Overlapping with sense strand of si:dkey-229p15.1-001 (intron 1). |
(Ensemble: OTTDART00000039497) |
mature miRNAs for MI0010842: |
dre-miR-2191 (MIMAT0011300): TCACACCTACAATCCCTGGCA |
You can find this miRNA in ENTREZGENE: mir2191 (accession: 100310769) |
References |
[1]Soares AR, Pereira PM, Santos B, Egas C, Gomes AC, Arrais J, Oliveira JL, Moura GR, Santos MA, BMC Genomics. 10:195(2009)., "Parallel DNA pyrosequencing unveils new zebrafish microRNAs" |