miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0010842
Located between position 36885952 and 36886061 on chromosome 23 strand +
Overlapping with sense strand of si:dkey-229p15.1-001 (intron 1).
(Ensemble: OTTDART00000039497)
mature miRNAs for MI0010842:
         dre-miR-2191 (MIMAT0011300): TCACACCTACAATCCCTGGCA
You can find this miRNA in ENTREZGENE: mir2191 (accession: 100310769)

References
[1]Soares AR, Pereira PM, Santos B, Egas C, Gomes AC, Arrais J, Oliveira JL, Moura GR, Santos MA, BMC Genomics. 10:195(2009)., "Parallel DNA pyrosequencing unveils new zebrafish microRNAs"