| Basic information from miRBase |
| hairpin accession number: MI0010846 |
| Located between position 33604044 and 33604153 on chromosome 12 strand + |
| Overlapping with antisense strand of CR385040.2-201 (exon 9). |
| (Ensemble: ENSDART00000112881) |
| mature miRNAs for MI0010846: |
| dre-miR-2196 (MIMAT0011304): CCTCTCTGTGCTGCCATTTGGGAC |
| You can find this miRNA in ENTREZGENE: mir2196 (accession: 100310759) |
| References |
| [1]Soares AR, Pereira PM, Santos B, Egas C, Gomes AC, Arrais J, Oliveira JL, Moura GR, Santos MA, BMC Genomics. 10:195(2009)., "Parallel DNA pyrosequencing unveils new zebrafish microRNAs" |