| Basic information from miRBase |
| hairpin accession number: MI0001912 |
| Located between position 13813148 and 13813229 on chromosome 5 strand + |
| Overlapping with sense strand of si:dkey-98f17.5-001 (intron 4). |
| (Ensemble: OTTDART00000030000) |
| mature miRNAs for MI0001912: |
| dre-miR-22b (MIMAT0001789): AAGCTGCCAGTTGAAGAGCTGT |
| You can find this miRNA in ENTREZGENE: mir22b (accession: 100033585) |
| References |
| [1]Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T, Genes Dev. 19:1288-1293(2005)., "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" |