miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0001915
Located between position 13304718 and 13304815 on chromosome 3 strand -
mature miRNAs for MI0001915:
         dre-miR-23a (MIMAT0001790): ATCACATTGCCAGGGATTTCCA
You can find this miRNA in ENTREZGENE: mir23a-2 (accession: 100033587)

References
[1]Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T, Genes Dev. 19:1288-1293(2005)., "The developmental miRNA profiles of zebrafish as determined by small RNA cloning"