| Basic information from miRBase |
| hairpin accession number: MI0001917 |
| Located between position 15983153 and 15983233 on chromosome 10 strand + |
| Overlapping with antisense strand of si:dkey-3h23.2-002 (exon 3). |
| (Ensemble: OTTDART00000043259) |
| mature miRNAs for MI0001917: |
| dre-miR-23b (MIMAT0001791): ATCACATTGCCAGGGATTACCA |
| You can find this miRNA in ENTREZGENE: mir23b (accession: 100033589) |
| References |
| [1]Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T, Genes Dev. 19:1288-1293(2005)., "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" |