| Basic information from miRBase |
| hairpin accession number: MI0001920 |
| Located between position 31010534 and 31010675 on chromosome 8 strand - |
| Overlapping with sense strand of zgc:162939-004 (intron 5). |
| (Ensemble: OTTDART00000035785) |
| mature miRNAs for MI0001920: |
| dre-miR-24 (MIMAT0001792): TGGCTCAGTTCAGCAGGAACAG |
| You can find this miRNA in ENTREZGENE: mir24-3 (accession: 100033592) |
| References |
| [1]Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T, Genes Dev. 19:1288-1293(2005)., "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" |