| Basic information from miRBase |
| hairpin accession number: MI0001922 |
| Located between position 205362 and 205443 on chromosome 14 strand - |
| Overlapping with sense strand of mcm7-201 (intron 13). |
| (Ensemble: ENSDART00000051890) |
| mature miRNAs for MI0001922: |
| dre-miR-25 (MIMAT0001793): CATTGCACTTGTCTCGGTCTGA |
| You can find this miRNA in ENTREZGENE: mir25 (accession: 100033594) |
| References |
| [1]Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T, Genes Dev. 19:1288-1293(2005)., "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" |