| Basic information from miRBase |
| hairpin accession number: MI0001926 |
| Located between position 21079406 and 21079542 on chromosome 24 strand - |
| Overlapping with sense strand of ctdspla-005 (intron 3). |
| (Ensemble: OTTDART00000039208) |
| mature miRNAs for MI0001926: |
| dre-miR-26a (MIMAT0001794): TTCAAGTAATCCAGGATAGGCT |
| You can find this miRNA in ENTREZGENE: mir26a-3 (accession: 100033597) |
| References |
| [1]Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T, Genes Dev. 19:1288-1293(2005)., "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" |