| Basic information from miRBase |
| hairpin accession number: MI0001940 |
| Located between position 4497677 and 4497765 on chromosome 19 strand + |
| mature miRNAs for MI0001940: |
| dre-miR-30a (MIMAT0001803): TGTAAACATTCCCGACTGGAAG |
| You can find this miRNA in ENTREZGENE: mir30a (accession: 100033609) |
| References |
| [1]Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T, Genes Dev. 19:1288-1293(2005)., "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" |