| Basic information from miRBase |
| hairpin accession number: MI0001365 |
| Located between position 22885200 and 22885297 on chromosome 23 strand + |
| Overlapping with antisense strand of si:ch211-28e16.5-001 (exon 3). |
| (Ensemble: OTTDART00000042065) |
| mature miRNAs for MI0001365: |
| dre-miR-34 (MIMAT0001269): TGGCAGTGTCTTAGCTGGTTGT |
| You can find this miRNA in ENTREZGENE: mir34 (accession: 100033759) |
| References |
| [1]Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP, Science. 299:1540(2003)., "Vertebrate microRNA genes" |
| [2]Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T, Genes Dev. 19:1288-1293(2005)., "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" |