| Basic information from miRBase |
| hairpin accession number: MI0004786 |
| Located between position 29153407 and 29153519 on chromosome 1 strand + |
| Overlapping with sense strand of vps8-001 (intron 8). |
| (Ensemble: OTTDART00000046793) |
| mature miRNAs for MI0004786: |
| dre-miR-740 (MIMAT0003771): ATAAAAAGTGGTATGGTACAGT |
| You can find this miRNA in ENTREZGENE: mir740 (accession: 100033753) |
| References |
| [1]Kloosterman WP, Steiner FA, Berezikov E, de Bruijn E, van de Belt J, Verheul M, Cuppen E, Plasterk RH, Nucleic Acids Res. 34:2558-2569(2006)., "Cloning and expression of new microRNAs from zebrafish" |