miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0001879
Located between position 451272 and 451391 on chromosome 8 strand +
Overlapping with sense strand of fem1c-201 (intron 3).
(Ensemble: ENSDART00000017718)
mature miRNAs for MI0001879:
         dre-miR-7a (MIMAT0001266): TGGAAGACTAGTGATTTTGTTGT
You can find this miRNA in ENTREZGENE: mir7a-3 (accession: 100033552)

References
[1]Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T, Genes Dev. 19:1288-1293(2005)., "The developmental miRNA profiles of zebrafish as determined by small RNA cloning"