| Basic information from miRBase |
| hairpin accession number: MI0001880 |
| Located between position 31444462 and 31444548 on chromosome 16 strand + |
| mature miRNAs for MI0001880: |
| dre-miR-9 (MIMAT0001769): TCTTTGGTTATCTAGCTGTATGA |
| dre-miR-9* (MIMAT0003156): TAAAGCTAGATAACCGAAAGT |
| You can find this miRNA in ENTREZGENE: mir9-1 (accession: 100033553) |
| References |
| [1]Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T, Genes Dev. 19:1288-1293(2005)., "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" |
| [2]Wienholds E, Kloosterman WP, Miska E, Alvarez-Saavedra E, Berezikov E, de Bruijn E, Horvitz HR, Kauppinen S, Plasterk RH, Science. 309:310-311(2005)., "MicroRNA expression in zebrafish embryonic development" |