| Basic information from miRBase |
| hairpin accession number: MI0001952 |
| Located between position 55420212 and 55420306 on chromosome 9 strand - |
| mature miRNAs for MI0001952: |
| dre-miR-92a (MIMAT0001808): TATTGCACTTGTCCCGGCCTGT |
| You can find this miRNA in ENTREZGENE: mir92a-2 (accession: 100033615) |
| References |
| [1]Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T, Genes Dev. 19:1288-1293(2005)., "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" |