| Basic information from miRBase |
| hairpin accession number: MI0012925 |
| Located between position 15509722 and 15509792 on chromosome 26 strand + |
| mature miRNAs for MI0012925: |
| eca-let-7c (MIMAT0013181): TGAGGTAGTAGGTTGTATGGTT |
| You can find this miRNA in ENTREZGENE: MIRLET7C (accession: 100315026) |
| References |
| [1]Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y, Genomics. 94:125-131(2009)., "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" |