| Basic information from miRBase |
| hairpin accession number: MI0012820 |
| Located between position 35442180 and 35442267 on chromosome 16 strand + |
| Overlapping with sense strand of LOC100060351 (intron 1). |
| (Ensemble: ENSECAT00000015138) |
| mature miRNAs for MI0012820: |
| eca-let-7g (MIMAT0013075): TGAGGTAGTAGTTTGTACAGTT |
| You can find this miRNA in ENTREZGENE: MIRLET7G (accession: 100314867) |
| References |
| [1]Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y, Genomics. 94:125-131(2009)., "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" |