| Basic information from miRBase |
| hairpin accession number: MI0012854 |
| Located between position 19043286 and 19043363 on chromosome 22 strand - |
| Overlapping with sense strand of LOC100066127 (intron 5). |
| (Ensemble: ENSECAT00000018679) |
| mature miRNAs for MI0012854: |
| eca-miR-103 (MIMAT0013105): AGCAGCATTGTACAGGGCTATGA |
| You can find this miRNA in ENTREZGENE: MIR103 (accession: 100314886) |
| References |
| [1]Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y, Genomics. 94:125-131(2009)., "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" |