| Basic information from miRBase |
| hairpin accession number: MI0012797 |
| Located between position 8034691 and 8034749 on chromosome 13 strand - |
| Overlapping with sense strand of LOC100068673 (intron 13). |
| (Ensemble: ENSECAT00000015853) |
| mature miRNAs for MI0012797: |
| eca-miR-106b (MIMAT0013054): TAAAGTGCTGACAGTGCAGAT |
| You can find this miRNA in ENTREZGENE: MIR106B (accession: 100314855) |
| References |
| [1]Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y, Genomics. 94:125-131(2009)., "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" |