| Basic information from miRBase |
| hairpin accession number: MI0012805 |
| Located between position 12370468 and 12370539 on chromosome 14 strand + |
| Overlapping with sense strand of PANK3 (intron 5). |
| (Ensemble: ENSECAT00000022424) |
| mature miRNAs for MI0012805: |
| eca-miR-107a (MIMAT0013061): AGCAGCATTGTACAGGGCTATGA |
| You can find this miRNA in ENTREZGENE: MIR107A (accession: 100315064) |
| References |
| [1]Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y, Genomics. 94:125-131(2009)., "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" |