| Basic information from miRBase |
| hairpin accession number: MI0012919 |
| Located between position 37315402 and 37315474 on chromosome 25 strand - |
| Overlapping with sense strand of LOC100066378 (intron 7). |
| (Ensemble: ENSECAT00000016463) |
| mature miRNAs for MI0012919: |
| eca-miR-126-5p (MIMAT0013176): CATTATTACTTTTGGTACGCG |
| eca-miR-126-3p (MIMAT0013177): TCGTACCGTGAGTAATAATGCG |
| You can find this miRNA in ENTREZGENE: MIR126 (accession: 100315085) |
| References |
| [1]Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y, Genomics. 94:125-131(2009)., "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" |