| Basic information from miRBase |
| hairpin accession number: MI0012821 |
| Located between position 49087163 and 49087246 on chromosome 16 strand - |
| Overlapping with sense strand of LOC100050660 (intron 16). |
| (Ensemble: ENSECAT00000024792) |
| mature miRNAs for MI0012821: |
| eca-miR-128 (MIMAT0013076): TCACAGTGAACCGGTCTCTTT |
| You can find this miRNA in ENTREZGENE: MIR128 (accession: 100314868) |
| References |
| [1]Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y, Genomics. 94:125-131(2009)., "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" |