| Basic information from miRBase |
| hairpin accession number: MI0012663 |
| Located between position 43476729 and 43476786 on chromosome 2 strand - |
| Overlapping with sense strand of CAMTA1 (intron 2). |
| (Ensemble: ENSECAT00000022455) |
| mature miRNAs for MI0012663: |
| eca-miR-1302 (MIMAT0012907): TTGGGACATACTTATACTAAA |
| You can find this miRNA in ENTREZGENE: MIR1302-1 (accession: 100315099) |
| References |
| [1]Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y, Genomics. 94:125-131(2009)., "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" |