| Basic information from miRBase |
| hairpin accession number: MI0012682 |
| Located between position 19908675 and 19908735 on chromosome 3 strand + |
| Overlapping with sense strand of LOC100067291 (intron 15). |
| (Ensemble: ENSECAT00000007141) |
| mature miRNAs for MI0012682: |
| eca-miR-140-5p (MIMAT0012926): CAGTGGTTTTACCCTATGGTAG |
| eca-miR-140-3p (MIMAT0012927): TACCACAGGGTAGAACCACGG |
| You can find this miRNA in ENTREZGENE: MIR140 (accession: 100315002) |
| References |
| [1]Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y, Genomics. 94:125-131(2009)., "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" |